pVQ CMV NanoV1-2a-EGFP ferritin
(Plasmid #79649)

• Purpose: Expresses camelid anti-GFP nanobody fused to TRPV1 and GFP-ferritin chimera fusion protein
• Depositing Lab: Jeffrey Friedman
• Publication: Stanley et al Nature. 2016 Mar 31;531(7596):647-50. doi: 10.1038/nature17183. Epub 2016 Mar 23.

Backbone

• Vector backbone: pVQAd-AscI-CMV-NPa
• Backbone manufacturer: Viraquest
• Backbone size w/o insert (bp): 6217
• Total vector size (bp): 11351
• Modifications to backbone: none
• Vector type: Mammalian Expression, Adenoviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: transient receptor potential vanillin 1
• Alt name: TRPV1
• Species: R. norvegicus (rat)
• Insert Size (bp): 2512
• Entrez Gene: Trpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: avrII (not destroyed)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: ggtctatataagcagagctg

Gene/Insert 2

• Gene/Insert name: camelid anti-GFP nanobody
• Species: camelid
• Insert Size (bp): 351
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ctagtgccaccATGGCCGATGTGCAG

Gene/Insert 3

• Gene/Insert name: Enhanced green fluorescent protein
• Alt name: EGFP
• Insert Size (bp): 717
• Promoter: CMV

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: gagcttctccctgaggtca

Gene/Insert 4

• Gene/Insert name: mouse ferritin light chain
• Species: M. musculus (mouse)
• Insert Size (bp): 549
• Entrez Gene: Ftl1 (a.k.a. Ftl, Ftl-1, L-ferritin)
• Promoter: CMV

Cloning Information for Gene/Insert 4

• Cloning method: Unknown
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG

Gene/Insert 5

• Gene/Insert name: mouse ferritin heavy chain
• Species: M. musculus (mouse)
• Entrez Gene: Fth1 (a.k.a. FHC, Fth, HFt, MFH)
• Promoter: CMV

Cloning Information for Gene/Insert 5

• Cloning method: Unknown
• 5′ sequencing primer: GACTACAAGGACGACGACGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Wolfgang Liedtke
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry