Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTKEI-Tre-C04
(Plasmid #79754)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79754 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTKEI-Dest
  • Backbone size w/o insert (bp) 3712
  • Total vector size (bp) 5695
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tre-C04
  • Insert Size (bp)
    1983
  • Promoter pTrc
  • Tag / Fusion Protein
    • 6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer AATGTGTGGAATTGTGAGCG
  • 3′ sequencing primer CAGACCGCTTCTGCGTTCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTKEI-Tre-C04 was a gift from David Savage (Addgene plasmid # 79754 ; http://n2t.net/addgene:79754 ; RRID:Addgene_79754)
  • For your References section:

    Rapid construction of metabolite biosensors using domain-insertion profiling. Nadler DC, Morgan SA, Flamholz A, Kortright KE, Savage DF. Nat Commun. 2016 Jul 29;7:12266. doi: 10.1038/ncomms12266. 10.1038/ncomms12266 PubMed 27470466