-
PurposeSingle fluorescent protein biosensor for trehalose
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79754 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTKEI-Dest
- Backbone size w/o insert (bp) 3712
- Total vector size (bp) 5695
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTre-C04
-
Insert Size (bp)1983
- Promoter pTrc
-
Tag
/ Fusion Protein
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer AATGTGTGGAATTGTGAGCG
- 3′ sequencing primer CAGACCGCTTCTGCGTTCTG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTKEI-Tre-C04 was a gift from David Savage (Addgene plasmid # 79754 ; http://n2t.net/addgene:79754 ; RRID:Addgene_79754) -
For your References section:
Rapid construction of metabolite biosensors using domain-insertion profiling. Nadler DC, Morgan SA, Flamholz A, Kortright KE, Savage DF. Nat Commun. 2016 Jul 29;7:12266. doi: 10.1038/ncomms12266. 10.1038/ncomms12266 PubMed 27470466