Skip to main content
Addgene

pKA-207I10
(Plasmid #79845)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79845 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIRES-mCherry
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 10100
  • Modifications to backbone
    IRES strength was reduced ~ 3-fold
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-PpsR2-VP16-IRESI10-BphP1-mCherry-TetR
  • Species
    Rhodopseudomonas palustris
  • Insert Size (bp)
    6200
  • Mutation
    RpPpsR2 cysteine 439 changed to serine
  • GenBank ID
    KX063612 KX063613
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    A RpBphP1 gene of R. palustris (NCBI Gene rpa1537) was provided by E. Giraud (Institute for Research and Development, France). A RpPpsR2 gene of R. palustris (NCBI Gene rpa1536) (accession code CAE26978) was provided by M. Papiz (Liverpool University, UK) and T. Beatty (University of British Columbia, Canada).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKA-207I10 was a gift from Vladislav Verkhusha (Addgene plasmid # 79845 ; http://n2t.net/addgene:79845 ; RRID:Addgene_79845)
  • For your References section:

    A bacterial phytochrome-based optogenetic system controllable with near-infrared light. Kaberniuk AA, Shemetov AA, Verkhusha VV. Nat Methods. 2016 May 9. doi: 10.1038/nmeth.3864. 10.1038/nmeth.3864 PubMed 27159085