Skip to main content

pJMP1
(Plasmid #79873)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79873 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAX01
  • Backbone size w/o insert (bp) 7781
  • Total vector size (bp) 12080
  • Modifications to backbone
    dcas9 was PCR-amplified from pdCas9-bacteria (Addgene #44249) using primers containing BamHI-compatible BsaI sites, digested with BsaI, then ligated into plasmid pAX01 digested with BamHI to generate pJMP1
  • Vector type
    Bacterial Expression, CRISPR
  • Selectable markers
    Bacillus subtilis erythromycin/lincomycin marker

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9
  • Alt name
    catalytically inactive Cas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4107
  • Mutation
    D10A, H840A
  • Promoter xylA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TCCTTTGTTTATCCACCGAAC
  • 3′ sequencing primer GCCTCGTGATACGCCTATTT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    dcas9 was PCR-amplified from pdCas9-bacteria (Addgene #44249)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMP1 was a gift from Carol Gross & Jason Peters & Stanley Qi (Addgene plasmid # 79873 ; http://n2t.net/addgene:79873 ; RRID:Addgene_79873)
  • For your References section:

    A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Peters JM, Colavin A, Shi H, Czarny TL, Larson MH, Wong S, Hawkins JS, Lu CH, Koo BM, Marta E, Shiver AL, Whitehead EH, Weissman JS, Brown ED, Qi LS, Huang KC, Gross CA. Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26. 10.1016/j.cell.2016.05.003 PubMed 27238023