-
PurposeBacillus subtilis dCas9 expression vector; integrates into lacA/ganA
-
Depositing Labs
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAX01
- Backbone size w/o insert (bp) 7781
- Total vector size (bp) 12080
-
Modifications to backbonedcas9 was PCR-amplified from pdCas9-bacteria (Addgene #44249) using primers containing BamHI-compatible BsaI sites, digested with BsaI, then ligated into plasmid pAX01 digested with BamHI to generate pJMP1
-
Vector typeBacterial Expression, CRISPR
-
Selectable markersBacillus subtilis erythromycin/lincomycin marker
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9
-
Alt namecatalytically inactive Cas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4107
-
MutationD10A, H840A
- Promoter xylA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TCCTTTGTTTATCCACCGAAC
- 3′ sequencing primer GCCTCGTGATACGCCTATTT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydcas9 was PCR-amplified from pdCas9-bacteria (Addgene #44249)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJMP1 was a gift from Carol Gross & Jason Peters & Stanley Qi (Addgene plasmid # 79873 ; http://n2t.net/addgene:79873 ; RRID:Addgene_79873) -
For your References section:
A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Peters JM, Colavin A, Shi H, Czarny TL, Larson MH, Wong S, Hawkins JS, Lu CH, Koo BM, Marta E, Shiver AL, Whitehead EH, Weissman JS, Brown ED, Qi LS, Huang KC, Gross CA. Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26. 10.1016/j.cell.2016.05.003 PubMed 27238023