pCAG-Flp-DOG
(Plasmid
#80084)
-
PurposeFlp recombinase dependent on GFP (Flp-DOG) for expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG-GFP
- Backbone size w/o insert (bp) 4823
- Total vector size (bp) 6816
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlp-DOG
-
Alt namedGBP1x2-Flpo
-
SpeciesSynthetic
-
Insert Size (bp)1986
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGCCTCTGCTAACCATGTTC
- 3′ sequencing primer TAGCCAGAAGTCAGATGCTCAAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please cite: Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL (2016) Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Elife 5. doi:10.7554/eLife.15312
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-Flp-DOG was a gift from Connie Cepko (Addgene plasmid # 80084 ; http://n2t.net/addgene:80084 ; RRID:Addgene_80084) -
For your References section:
Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL. Elife. 2016 May 20;5. pii: e15312. doi: 10.7554/eLife.15312. 10.7554/eLife.15312 PubMed 27205882