-
PurposeMelanosome marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepiRFP682
- Backbone size w/o insert (bp) 4904
- Total vector size (bp) 6546
-
Modifications to backboneEGFP in pEGFP-N3 was replaced by iRFP682 to generate piRFP682-N3
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTyrosinase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1642
-
GenBank IDNM_000372
-
Entrez GeneTYR (a.k.a. ATN, CMM8, OCA1, OCA1A, OCAIA, SHEP3)
- Promoter CMV
-
Tag
/ Fusion Protein
- iRFP682 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CCTCTACAAATGTGGTATGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
piRFP-N3-Tyrosinase was a gift from Santiago Di Pietro (Addgene plasmid # 80152 ; http://n2t.net/addgene:80152 ; RRID:Addgene_80152) -
For your References section:
TPC2 controls pigmentation by regulating melanosome pH and size. Ambrosio AL, Boyle JA, Aradi AE, Christian KA, Di Pietro SM. Proc Natl Acad Sci U S A. 2016 May 17;113(20):5622-7. doi: 10.1073/pnas.1600108113. Epub 2016 May 2. 10.1073/pnas.1600108113 PubMed 27140606