-
PurposeFluorescent reporter for calcium signaling
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE
-
Backbone manufacturerRichard Mulligan
- Total vector size (bp) 7459
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGCaMP6f
-
SpeciesSynthetic
-
Insert Size (bp)1353
- Promoter RSV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ggtacagtgcaggggaaagaat
- 3′ sequencing primer gctattgcttcccgtatggctttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-RSV-GCAMP6f was a gift from Darrell Kotton (Addgene plasmid # 80315 ; http://n2t.net/addgene:80315 ; RRID:Addgene_80315) -
For your References section:
Unstable neurons underlie a stable learned behavior. Liberti WA 3rd, Markowitz JE, Perkins LN, Liberti DC, Leman DP, Guitchounts G, Velho T, Kotton DN, Lois C, Gardner TJ. Nat Neurosci. 2016 Oct 10. doi: 10.1038/nn.4405. 10.1038/nn.4405 PubMed 27723744