Skip to main content

pcDNA3-TDsmURFP-IRES-HO-1
(Plasmid #80346)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80346 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 6845
  • Total vector size (bp) 7715
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Tandem Dimer smURFP
  • Alt name
    Tandem Dimer small Ultra-Red Fluorescent Protein
  • Species
    Synthetic
  • Insert Size (bp)
    870
  • GenBank ID
    KX449135
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGCGTACAAGGGTACCGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HO-1
  • Alt name
    Heme Oxygenase-1
  • Species
    Synechocystis
  • Insert Size (bp)
    723
  • Promoter IRES

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer gtggctgcttatggtgacaatc
  • 3′ sequencing primer CCTCGACTGTGCCTTCTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    All constructs with HO-1 was initially obtained from Professor J. Clark Lagarias (University of California, Davis).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-TDsmURFP-IRES-HO-1 was a gift from Erik Rodriguez & Roger Tsien (Addgene plasmid # 80346 ; http://n2t.net/addgene:80346 ; RRID:Addgene_80346)
  • For your References section:

    A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein. Rodriguez EA, Tran GN, Gross LA, Crisp JL, Shu X, Lin JY, Tsien RY. Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935. 10.1038/nmeth.3935 PubMed 27479328