-
PurposegRNA expression vector with mCherry transfection control
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 2871
- Total vector size (bp) 5033
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesp Cas9 gRNA
-
Alt nameStreptococcus pyogenes guideRNA
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)76
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CCTCTGACTTGAGCGTCG
- 3′ sequencing primer AGTAGGAAAGTCCCGTAAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
Insert Size (bp)717
- Promoter chicken β-actin promoter
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer aagggatggttggttggtgg
- 3′ sequencing primer CCTTTCTCGCCACGTTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmCherry_gRNA was a gift from Ervin Welker (Addgene plasmid # 80457 ; http://n2t.net/addgene:80457 ; RRID:Addgene_80457) -
For your References section:
Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Kulcsar PI, Talas A, Huszar K, Ligeti Z, Toth E, Weinhardt N, Fodor E, Welker E. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. 10.1186/s13059-017-1318-8 [pii] PubMed 28985763