-
Purposedonor vector for AAVS1 targeting (puromycin selection) and constitutive mCherry expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 3000
-
Modifications to backboneHomology arms for AAVS1; promoter-less SA-T2A-puro selection cassette
-
Vector typeMammalian Expression ; donor vector (human)
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter CAG
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGCCTCTGCTAACCATGTTC
- 3′ sequencing primer ATTAGCCAGAAGTCAGATGC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Deleted T2 protospacer sequence in HA-R
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVS1-P-CAG-mCh was a gift from Knut Woltjen (Addgene plasmid # 80492 ; http://n2t.net/addgene:80492 ; RRID:Addgene_80492) -
For your References section:
Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Oceguera-Yanez F, Kim SI, Matsumoto T, Tan GW, Xiang L, Hatani T, Kondo T, Ikeya M, Yoshida Y, Inoue H, Woltjen K. Methods. 2015 Dec 18. pii: S1046-2023(15)30181-X. doi: 10.1016/j.ymeth.2015.12.012. 10.1016/j.ymeth.2015.12.012 PubMed 26707206