Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHD-DsRed-w+
(Plasmid #80926)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80926 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJ204
  • Backbone manufacturer
    DNA 2.0
  • Backbone size w/o insert (bp) 27848
  • Total vector size (bp) 7140
  • Vector type
    high copy, amp resistance

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    LoxP-3xP3-DsRed-LoxP
  • Species
    Synthetic
  • Insert Size (bp)
    1225
  • Promoter 3xP3

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ACGAAAGGCTCAGTCGAAAG
  • 3′ sequencing primer TGATATCAAAATTATACATGTCAACG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GMR-white
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    2997
  • Promoter GMR::hsp70

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCTGACGCTCAGTGGAACG
  • 3′ sequencing primer GAGTCAGGCAACTATGGATGAACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We had it synthesized by DNA 2.0

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHD-DsRed-w+ was a gift from Kate O'Connor-Giles (Addgene plasmid # 80926 ; http://n2t.net/addgene:80926 ; RRID:Addgene_80926)