pHD-DsRed-w+
(Plasmid
#80926)
-
PurposeVector for generating dsDNA donors for HDR. Contains the visible marker 3xP3-DsRed and GMR-white for identifying backbone incorporation.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJ204
-
Backbone manufacturerDNA 2.0
- Backbone size w/o insert (bp) 27848
- Total vector size (bp) 7140
-
Vector typehigh copy, amp resistance
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLoxP-3xP3-DsRed-LoxP
-
SpeciesSynthetic
-
Insert Size (bp)1225
- Promoter 3xP3
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ACGAAAGGCTCAGTCGAAAG
- 3′ sequencing primer TGATATCAAAATTATACATGTCAACG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGMR-white
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)2997
- Promoter GMR::hsp70
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCTGACGCTCAGTGGAACG
- 3′ sequencing primer GAGTCAGGCAACTATGGATGAACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe had it synthesized by DNA 2.0
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHD-DsRed-w+ was a gift from Kate O'Connor-Giles (Addgene plasmid # 80926 ; http://n2t.net/addgene:80926 ; RRID:Addgene_80926)