AAVS1-Pur-CAG-hM3Dq-mCherry
(Plasmid
#80948)
-
Purposehuman AAVS1 site targeting donor plasmid for knock-in hM3Dq-mCherry expression cassette driven by CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80948 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAVS1
- Backbone size w/o insert (bp) 10247
- Total vector size (bp) 12749
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehM3Dq-mCherry
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2502
- Promoter CAG promoter
-
Tag
/ Fusion Protein
- mcherry fusion (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer ggcttctggcgtgtgaccggc
- 3′ sequencing primer catagcgtaaaaggagcaaca
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe hM3Dq-mCherry cDNA was amplified from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (addgene #44361, Bryan Roth Lab)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Pur-CAG-hM3Dq-mCherry was a gift from Su-Chun Zhang (Addgene plasmid # 80948 ; http://n2t.net/addgene:80948 ; RRID:Addgene_80948) -
For your References section:
Chemical Control of Grafted Human PSC-Derived Neurons in a Mouse Model of Parkinson's Disease. Chen Y, Xiong M, Dong Y, Haberman A, Cao J, Liu H, Zhou W, Zhang SC. Cell Stem Cell. 2016 Jun 2;18(6):817-26. doi: 10.1016/j.stem.2016.03.014. Epub 2016 Apr 28. 10.1016/j.stem.2016.03.014 PubMed 27133795