Skip to main content
Addgene

WT1-2A-eGFP PGK PuroR Donor Plasmid
(Plasmid #82333)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82333 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    OCT4-2A-eGFP
  • Backbone manufacturer
    Addgene #31939
  • Backbone size w/o insert (bp) 6804
  • Total vector size (bp) 10650
  • Modifications to backbone
    Replacing OCT4 5' and 3' arms with WT1 arms
  • Vector type
    Mammalian Expression, CRISPR, TALEN
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    WT1 5' Arm
  • Alt name
    Wilms tumor 1
  • Alt name
    AWT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1990
  • GenBank ID
    Gene ID 7490
  • Entrez Gene
    WT1 (a.k.a. AWT1, GUD, NPHS4, WAGR, WIT-2, WT-1, WT33)
  • Tag / Fusion Protein
    • 2A-eGFP (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGGAAACAGCTATGAC
  • 3′ sequencing primer CCGGGATTCTCTTCGACAT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    WT1 3' Arm
  • Alt name
    Wilms tumor 1
  • Alt name
    AWT1
  • Insert Size (bp)
    2046
  • Entrez Gene
    WT1 (a.k.a. AWT1, GUD, NPHS4, WAGR, WIT-2, WT-1, WT33)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGAGATCAGCAGCCTCTGT
  • 3′ sequencing primer TGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    WT1-2A-eGFP PGK PuroR Donor Plasmid was a gift from Sean Palecek (Addgene plasmid # 82333 ; http://n2t.net/addgene:82333 ; RRID:Addgene_82333)
  • For your References section:

    Long-term self-renewing human epicardial cells generated from pluripotent stem cells under defined xeno-free conditions. Bao X, Lian X, Hacker TA, Schmuck EG, Qian T, Bhute VJ, Han T, Shi M, Drowley L, Plowright A, Wang QD, Goumans MJ, Palecek SP. Nat Biomed Eng. 2016;1. pii: 0003. doi: 10.1038/s41551-016-0003. Epub 2016 Dec 5. 10.1038/s41551-016-0003 PubMed 28462012