Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

WT1 KI gRNA2
(Plasmid #92313)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92313 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    CRISPR-eGFP
  • Backbone size w/o insert (bp) 9289
  • Total vector size (bp) 9291
  • Modifications to backbone
    gRNA1 targeting WT1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    WT1
  • Alt name
    AWT1
  • gRNA/shRNA sequence
    GGACACTGAACGGTCCCCGA (gRNA shown is without PAM sequence)
  • Species
    H. sapiens (human)
  • GenBank ID
    7490
  • Entrez Gene
    WT1 (a.k.a. AWT1, GUD, NPHS4, WAGR, WIT-2, WT-1, WT33)
  • Promoter U6
  • Tag / Fusion Protein
    • CRISPR GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BBSI (destroyed during cloning)
  • 3′ cloning site BBSI (destroyed during cloning)
  • 5′ sequencing primer tttcttgggtagtttgcagtttt
  • 3′ sequencing primer CGGGTACCTCTAGAGCCATTT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    WT1 KI gRNA2 was a gift from Sean Palecek (Addgene plasmid # 92313 ; http://n2t.net/addgene:92313 ; RRID:Addgene_92313)
  • For your References section:

    Long-term self-renewing human epicardial cells generated from pluripotent stem cells under defined xeno-free conditions. Bao X, Lian X, Hacker TA, Schmuck EG, Qian T, Bhute VJ, Han T, Shi M, Drowley L, Plowright A, Wang QD, Goumans MJ, Palecek SP. Nat Biomed Eng. 2016;1. pii: 0003. doi: 10.1038/s41551-016-0003. Epub 2016 Dec 5. 10.1038/s41551-016-0003 PubMed 28462012