WT1-2A-eGFP PGK PuroR Donor Plasmid
(Plasmid #82333)

• Purpose: WT1 targeting donor
• Depositing Lab: Sean Palecek
• Publication: Bao et al Nat Biomed Eng. 2016;1. pii: 0003. doi: 10.1038/s41551-016-0003. Epub 2016 Dec 5.

Backbone

• Vector backbone: OCT4-2A-eGFP
• Backbone manufacturer: Addgene #31939
• Backbone size w/o insert (bp): 6804
• Total vector size (bp): 10650
• Modifications to backbone: Replacing OCT4 5' and 3' arms with WT1 arms
• Vector type: Mammalian Expression, CRISPR, TALEN
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: WT1 5' Arm
• Alt name: Wilms tumor 1
• Alt name: AWT1
• Species: H. sapiens (human)
• Insert Size (bp): 1990
• GenBank ID: Gene ID 7490
• Entrez Gene: WT1 (a.k.a. AWT1, GUD, NPHS4, WAGR, WIT-2, WT-1, WT33)
• Tag / Fusion Protein:
  • 2A-eGFP (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGGAAACAGCTATGAC
• 3′ sequencing primer: CCGGGATTCTCTTCGACAT

Gene/Insert 2

• Gene/Insert name: WT1 3' Arm
• Alt name: Wilms tumor 1
• Alt name: AWT1
• Insert Size (bp): 2046
• Entrez Gene: WT1 (a.k.a. AWT1, GUD, NPHS4, WAGR, WIT-2, WT-1, WT33)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACGAGATCAGCAGCCTCTGT
• 3′ sequencing primer: TGTAAAACGACGGCCAGT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry