pYFP.LIC.HXGPRT
              
              
                (Plasmid
                
                #83128)
              
            
            
            
          - 
            PurposePlasmid contains LIC cassette upstream of an in-frame copy of YFP and HXGPRT selectable marker cassette for endogenous tagging on the gene locus.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepKS
- 
              Vector typeToxoplasma gondii
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameYFP
- Promoter Endogenous Gene
- 
    
        Tag
        / Fusion Protein
    - YFP
 
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TACTTCCAATCCAATTTAGC
- 3′ sequencing primer TCCTCCACTTCCAATTTTAGC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pYFP.LIC.HXGPRT was a gift from Vernon Carruthers (Addgene plasmid # 83128 ; http://n2t.net/addgene:83128 ; RRID:Addgene_83128)
- 
                For your References section: Tagging of endogenous genes in a Toxoplasma gondii strain lacking Ku80. Huynh MH, Carruthers VB. Eukaryot Cell. 2009 Apr;8(4):530-9. doi: 10.1128/EC.00358-08. Epub 2009 Feb 13. 10.1128/EC.00358-08 PubMed 19218426
 
    
 
                         
             
            