Skip to main content

pJAG98-mTurquoise2-FHA2-AURKB substrate-YPet
(Plasmid #83286)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83286 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJAG98 (pBABE-blast)
  • Backbone size w/o insert (bp) 4993
  • Total vector size (bp) 6970
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mTurquoise2-FHA2-AURKB substrate-YPet
  • Alt name
    Aurora B FRET sensor
  • Insert Size (bp)
    1998

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTTATCCAGCCCTCAC
  • 3′ sequencing primer ACCCTAACTGACACACATTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJAG98-mTurquoise2-FHA2-AURKB substrate-YPet was a gift from Daniel Needleman (Addgene plasmid # 83286 ; http://n2t.net/addgene:83286 ; RRID:Addgene_83286)
  • For your References section:

    Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments. Yoo TY, Choi JM, Conway W, Yu CH, Pappu RV, Needleman DJ. Elife. 2018 Jul 25;7. pii: 36392. doi: 10.7554/eLife.36392. 36392 [pii] PubMed 30044223