pTriEX-Antenna-GDI Rac1
(Plasmid
#83359)
-
PurposeExpression of Antenna-Rac1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83359 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTriEx
- Backbone size w/o insert (bp) 5238
- Total vector size (bp) 7228
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRac1
-
Alt nameras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1990
-
Entrez GeneRAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- His (N terminal on backbone)
- FRET Antenna (mCerulean-cpVenus) (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aagtatcgggccctttgtgc
- 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTriEX-Antenna-GDI Rac1 was a gift from Klaus Hahn (Addgene plasmid # 83359 ; http://n2t.net/addgene:83359 ; RRID:Addgene_83359) -
For your References section:
FRET binding antenna reports spatiotemporal dynamics of GDI-Cdc42 GTPase interactions. Hodgson L, Spiering D, Sabouri-Ghomi M, Dagliyan O, DerMardirossian C, Danuser G, Hahn KM. Nat Chem Biol. 2016 Aug 8. doi: 10.1038/nchembio.2145. 10.1038/nchembio.2145 PubMed 27501396