pSELECT-HA-mFOXO1-D256
(Plasmid
#83379)
-
Purposeexpresses mouse FOXO1 with truncating mutation at AA 256 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83379 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSELECT-puro
-
Backbone manufacturerInvivogen
- Backbone size w/o insert (bp) 3390
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameForkhead box O1
-
Alt nameFoxO1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)768
-
MutationN256TAG (premature stop codon)
-
GenBank IDNM_019739.3
-
Entrez GeneFoxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
- Promoter EF-1a
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GACCCTGCTTGCTCAACTCT
- 3′ sequencing primer GAGCTCAGCCGAGAAGAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFOXO1-D256 was cloned from Myc-FOXO1 D256 containing dominant-negative mouse FOXO1 truncation mutant ORF fused to myc-tag was obtained from AddGene (plasmid 12145) originally constructed by Nakae and coworkers (EMBO J 19:989, 2000)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSELECT-HA-mFOXO1-D256 was a gift from Steven Abcouwer (Addgene plasmid # 83379 ; http://n2t.net/addgene:83379 ; RRID:Addgene_83379)