-
PurposeMammalian expression of Cas9 and sgRNA scaffold
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83480 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2 (#52961)
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 14873
-
Modifications to backbonepuromycin N-acetyltransferase was replaced by blasticidin S deaminase
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsNo more than 16-hour culture.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBlasticidin S deaminase
-
MutationReplaced puromycin N-acetyltransferase on the original plasmid
- Promoter EF-1α
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer TGCTGAAACAAGCCGGAGAT
- 3′ sequencing primer AATTAGCCCTTCCAGTCCCC, WPRE_R (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byFeng Zhang (backbone from lentiCRISPR v2 #52961, insert from lentiCas9-Blast #52962).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
lentiCas9-Blast was digested with BamHI and SacII. The resulting small fragment (encoding P2A, blasticidin and a portion of WPRE) was gel-purified. lentiCRISPR v2 was similarly digested and the larger fragment gel-purified. The two fragments combined and ligated.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2-Blast was a gift from Mohan Babu (Addgene plasmid # 83480 ; http://n2t.net/addgene:83480 ; RRID:Addgene_83480)