Skip to main content

lentiCRISPR v2-Blast
(Plasmid #83480)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83480 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2 (#52961)
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 14873
  • Modifications to backbone
    puromycin N-acetyltransferase was replaced by blasticidin S deaminase
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    No more than 16-hour culture.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Blasticidin S deaminase
  • Mutation
    Replaced puromycin N-acetyltransferase on the original plasmid
  • Promoter EF-1α

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer TGCTGAAACAAGCCGGAGAT
  • 3′ sequencing primer AATTAGCCCTTCCAGTCCCC, WPRE_R
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    Feng Zhang (backbone from lentiCRISPR v2 #52961, insert from lentiCas9-Blast #52962).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

lentiCas9-Blast was digested with BamHI and SacII. The resulting small fragment (encoding P2A, blasticidin and a portion of WPRE) was gel-purified. lentiCRISPR v2 was similarly digested and the larger fragment gel-purified. The two fragments combined and ligated.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-Blast was a gift from Mohan Babu (Addgene plasmid # 83480 ; http://n2t.net/addgene:83480 ; RRID:Addgene_83480)

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out these options:

Learn More