Skip to main content

pIRES-hrGFP II-TET1
(Plasmid #83568)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83568 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIRES-hrGFPII
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 11908
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    We are successful if we use Stbl3 bacteria for transformation coupled with extended growth periods at 37 degrees.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tet Methylcytosine Dioxygenase 1
  • Alt name
    TET1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6408
  • GenBank ID
    NM_030625
  • Entrez Gene
    TET1 (a.k.a. CXXC6, LCX, bA119F7.1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3X FLAG tag (C terminal on backbone)
    • hr GFP II (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ATGGGCGGTAGGCGTGTA
  • 3′ sequencing primer ATGCAGTCGTCGAGGAATTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: This plasmid contains an I1123M mutation in Tet1 compared to NM_030625 that the depositor has confirmed does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIRES-hrGFP II-TET1 was a gift from Jean-Pierre Issa (Addgene plasmid # 83568 ; http://n2t.net/addgene:83568 ; RRID:Addgene_83568)
  • For your References section:

    TET1 is a maintenance DNA demethylase that prevents methylation spreading in differentiated cells. Jin C, Lu Y, Jelinek J, Liang S, Estecio MR, Barton MC, Issa JP. Nucleic Acids Res. 2014 Jun;42(11):6956-71. doi: 10.1093/nar/gku372. Epub 2014 May 29. 10.1093/nar/gku372 PubMed 24875481