-
PurposeLentiviral Sp dCas9-KRAB fusion with Hygromycin B resistance cassette.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUGW
- Total vector size (bp) 15000
-
Vector typeLentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehumanized dead Cas9 KRAB
-
SpeciesS. Pyogenes
-
MutationD10A and H840A
- Promoter Human Ubiquitin C Promoter
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGACGCCACACTGATTCAT
- 3′ sequencing primer CTACCGGTGGATGTGGAATG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameaminoglycoside phosphotransferase from E. coli
-
Alt nameaph(4)-Ia
-
Alt nameHygromycin resistance gene
-
SpeciesE. coli
-
Insert Size (bp)1026
- Promoter mouse phosphoglycerate kinase 1 promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTTACTAAGCCAGATGTG
- 3′ sequencing primer ATGAAAGCCATACGGGAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-dCas9-KRAB-PGK-HygR was a gift from Charles Gersbach (Addgene plasmid # 83890 ; http://n2t.net/addgene:83890 ; RRID:Addgene_83890) -
For your References section:
CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Klann TS, Black JB, Chellappan M, Safi A, Song L, Hilton IB, Crawford GE, Reddy TE, Gersbach CA. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853. 10.1038/nbt.3853 PubMed 28369033