Skip to main content

pSLQ2814 pPB: CAG-Puro-WPRE PGK-VPR-tagBFP-SpdCas9
(Plasmid #84247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84247 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PB
  • Backbone manufacturer
    System Biosciences
  • Total vector size (bp) 13189
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology ; PiggyBac
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    VPR-tagBFP-Sp dCas9
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    6546
  • Promoter PGK
  • Tags / Fusion Proteins
    • VPR (N terminal on insert)
    • tagBFP (N terminal on insert)
    • HA tag (C terminal on insert)
    • 2xNLS (SV40) (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gaaggtcctccggaggcc
  • 3′ sequencing primer CGGTCTGTATATCGAGGTTTATTTATTAATTTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Puro
  • Insert Size (bp)
    606
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tcggcttctggcgtgtga
  • 3′ sequencing primer AAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The dCas9 gene was a gift from Martin Jinek and Jennifer Doudna (UC Berkeley).
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ2814 pPB: CAG-Puro-WPRE PGK-VPR-tagBFP-SpdCas9 was a gift from Stanley Qi (Addgene plasmid # 84247 ; http://n2t.net/addgene:84247 ; RRID:Addgene_84247)
  • For your References section:

    Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, Qi LS. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. 10.1038/nmeth.4042 PubMed 27776111