-
PurposeExpression of Merlin with an alanine mutation at the Pak phosphorylation site
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84294 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMerlin (NF2)
-
SpeciesH. sapiens (human)
-
MutationS518A
-
Entrez GeneNF2 (a.k.a. ACN, BANF, SCH, SWNV, merlin-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Merlin with alanine mutation at Pak phosphorylation site
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-Merlin S518A was a gift from Jonathan Chernoff (Addgene plasmid # 84294 ; http://n2t.net/addgene:84294 ; RRID:Addgene_84294) -
For your References section:
p21-activated kinase links Rac/Cdc42 signaling to merlin. Xiao GH, Beeser A, Chernoff J, Testa JR. J Biol Chem. 2002 Jan 11. 277(2):883-6. 10.1074/jbc.C100553200 PubMed 11719502