pTWIN1-His6-Ssp-Httex1-7Q
(Plasmid
#84347)
-
PurposeExpression of the human Huntingtin Exon1 protein containing 7Q in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTWIN1
-
Backbone manufacturereBioLabs
- Backbone size w/o insert (bp) 5800
- Total vector size (bp) 6500
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHuntingtin Exon 1
-
Alt nameHttex1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)700
-
Entrez GeneHTT (a.k.a. HD, IT15, LOMARS)
- Promoter T7
-
Tag
/ Fusion Protein
- N-terminal His6-tagged intein Ssp
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe company GeneArt from Thermo Fisher Scientific performed the synthesis and subcloning
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTWIN1-His6-Ssp-Httex1-7Q was a gift from Hilal Lashuel (Addgene plasmid # 84347 ; http://n2t.net/addgene:84347 ; RRID:Addgene_84347) -
For your References section:
An Intein-based Strategy for the Production of Tag-free Huntingtin Exon 1 Proteins Enables New Insights into the Polyglutamine Dependence of Httex1 Aggregation and Fibril Formation. Vieweg S, Ansaloni A, Wang ZM, Warner JB, Lashuel HA. J Biol Chem. 2016 Jun 3;291(23):12074-86. doi: 10.1074/jbc.M116.713982. Epub 2016 Mar 21. 10.1074/jbc.M116.713982 PubMed 27002149