Skip to main content

B2M Bulldozer (gRNA crB2M_13)
(Plasmid #84381)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84381 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Modified TOPO
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    B2M Bulldozer crB2M_13 gRNA
  • gRNA/shRNA sequence
    GCTACTCTCTCTTTCTGGCC
  • Species
    H. sapiens (human)
  • Promoter hU6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer T7
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    B2M Bulldozer (gRNA crB2M_13) was a gift from Chad Cowan (Addgene plasmid # 84381 ; http://n2t.net/addgene:84381 ; RRID:Addgene_84381)
  • For your References section:

    Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Mandal PK, Ferreira LM, Collins R, Meissner TB, Boutwell CL, Friesen M, Vrbanac V, Garrison BS, Stortchevoi A, Bryder D, Musunuru K, Brand H, Tager AM, Allen TM, Talkowski ME, Rossi DJ, Cowan CA. Cell Stem Cell. 2014 Nov 6;15(5):643-52. doi: 10.1016/j.stem.2014.10.004. Epub 2014 Nov 6. 10.1016/j.stem.2014.10.004 PubMed 25517468