Skip to main content

pCRISPRyl_D17
(Plasmid #84611)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84611 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2623
  • Total vector size (bp) 11822
  • Vector type
    Yeast Expression, CRISPR, Synthetic Biology
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • gRNA/shRNA sequence
    TCCGTAATATAGGTGACGAC
  • Promoter UAS1B8-TEF(136)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BssHII (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TEF
  • 3′ sequencing primer CYC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene material #44380 (UAS1B8-TEF promoter) is used to express Cas9
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPRyl_D17 was a gift from Ian Wheeldon (Addgene plasmid # 84611 ; http://n2t.net/addgene:84611 ; RRID:Addgene_84611)
  • For your References section:

    Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. Schwartz C, Shabbir-Hussain M, Frogue K, Blenner M, Wheeldon I. ACS Synth Biol. 2016 Dec 19. 10.1021/acssynbio.6b00285 PubMed 27989123