pGem-nHyPer:cAPX
(Plasmid
#84736)
-
PurposeSimultaneous expresion of stromal HyPer2 and cytosolic Ascorbate peroxidase (APX) in plant cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84736 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGemini (Dr. Andrew Simkin)
-
Backbone manufacturerpGWB2
- Backbone size w/o insert (bp) 16636
- Total vector size (bp) 19435
-
Modifications to backbonebi-directional vector built in house where the expression of two transgenes is driven by back-to-back CaMV35s and Figwort Mosaic Virus (FMV) constitutive promoters.
-
Vector typePlant Expression
-
Selectable markersHygromycin ; Kanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameAPX1
-
Alt nameAT1G07890
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)753
-
Entrez GeneAPX1 (a.k.a. AT1G07890, ASCORBATE PEROXIDASE, ATAPX01, ATAPX1, CS1, F24B9.2, F24B9_2, MEE6, ascorbate peroxidase 1, maternal effect embryo arrest 6)
- Promoter pFMV/p35S
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer pFMV34S atcgagcagcagctggcttgtgg/pCaM35S catcgttgaagatgcctctgc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHyPer2 targeted to nucleus
- Promoter pFMV/p35S
-
Tags
/ Fusion Proteins
- NLS-SV40 (N terminal on insert)
- NLS-SV40 (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer pFMV34S atcgagcagcagctggcttgtgg/pCaM35S catcgttgaagatgcctctgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGem-nHyPer:cAPX was a gift from Philip Mullineaux (Addgene plasmid # 84736 ; http://n2t.net/addgene:84736 ; RRID:Addgene_84736) -
For your References section:
Photosynthesis-dependent H2O2 transfer from chloroplasts to nuclei provides a high-light signalling mechanism. Exposito-Rodriguez M, Laissue PP, Yvon-Durocher G, Smirnoff N, Mullineaux PM. Nat Commun. 2017 Jun 29;8(1):49. doi: 10.1038/s41467-017-00074-w. 10.1038/s41467-017-00074-w [pii] PubMed 28663550