Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLVX-EF1a-tetOn-IRES-G418 (EtO)
(Plasmid #84776)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84776 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PLVX TIGHT PURO
  • Backbone size w/o insert (bp) 7791
  • Total vector size (bp) 12292
  • Vector type
    Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Depositing lab suggests using Stbl3. Large plasmid may behave similarly to a low copy number plasmid.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TET OPERATOR
  • Promoter pTIGHT

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCAGAGCTCGTTTAGTG
  • 3′ sequencing primer CTAAAGCGCATGCTCCAGACTGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    JEROME MERTENS
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-EF1a-tetOn-IRES-G418 (EtO) was a gift from Fred Gage (Addgene plasmid # 84776 ; http://n2t.net/addgene:84776 ; RRID:Addgene_84776)
  • For your References section:

    Directly Reprogrammed Human Neurons Retain Aging-Associated Transcriptomic Signatures and Reveal Age-Related Nucleocytoplasmic Defects. Mertens J, Paquola AC, Ku M, Hatch E, Bohnke L, Ladjevardi S, McGrath S, Campbell B, Lee H, Herdy JR, Goncalves JT, Toda T, Kim Y, Winkler J, Yao J, Hetzer MW, Gage FH. Cell Stem Cell. 2015 Oct 6. pii: S1934-5909(15)00408-7. doi: 10.1016/j.stem.2015.09.001. 10.1016/j.stem.2015.09.001 PubMed 26456686