pEX-A-U6-MaSgRNA_PuroR
(Plasmid
#84780)
-
PurposeExpresses major satellite-specific sgRNA.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84780 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEX-A
- Backbone size w/o insert (bp) 5314
- Total vector size (bp) 5334
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemajor satellite-specific sgRNA
-
gRNA/shRNA sequenceGGCAAGAAAACTGAAAATCA
- Promoter U6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer 5´- GAG GGC CTA TTT CCC ATG ATT C-3´ (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEX-A-U6-MaSgRNA_PuroR was a gift from Heinrich Leonhardt (Addgene plasmid # 84780 ; http://n2t.net/addgene:84780 ; RRID:Addgene_84780) -
For your References section:
Determination of Local Chromatin Composition by CasID. Schmidtmann E, Anton T, Rombaut P, Herzog F, Leonhardt H. Nucleus. 2016 Sep 27:0. 10.1080/19491034.2016.1239000 PubMed 27676121