Skip to main content

Fireworks RFP[PTC+] (AVA2626)
(Plasmid #85444)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85444 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    2073 nt of YCplac33
  • Backbone size w/o insert (bp) 2073
  • Total vector size (bp) 15294
  • Vector type
    Mammalian Expression ; minimal backbone fragment for low-copy bacterial propagation
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    tDNA1 EF1alfa-5xtdTomato-TEVprotease-PEST-beta-globin(dI1)(PTC39)-BGH polyA tDNA2 FRT-HygromycinR
  • Insert Size (bp)
    13215

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer 5'- GTGAGTTAGCTCACTCATTAGGCACCC -3'
  • 3′ sequencing primer 5'- GTT CCG CGC ACA TTT CCC -3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Fireworks RFP[PTC+] (AVA2626) was a gift from Joan Steitz (Addgene plasmid # 85444 ; http://n2t.net/addgene:85444 ; RRID:Addgene_85444)
  • For your References section:

    Fluorescence Amplification Method for Forward Genetic Discovery of Factors in Human mRNA Degradation. Alexandrov A, Shu MD, Steitz JA. Mol Cell. 2017 Jan 5;65(1):191-201. doi: 10.1016/j.molcel.2016.11.032. Epub 2016 Dec 22. 10.1016/j.molcel.2016.11.032 PubMed 28017590