Fireworks GFP[PTC+] (AVA2600)
(Plasmid
#85446)
-
PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a PTC-containing beta-globin reporter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbone2073 nt of YCplac33
- Backbone size w/o insert (bp) 2073
- Total vector size (bp) 11448
-
Vector typeMammalian Expression ; minimal backbone fragment for low-copy bacterial propagation
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametDNA1 EF1alfa-5xEGFP-TEVprotease-PEST-beta-globin(dI1)(PTC39)-BGH polyA tDNA2 FRT-PEST-TEVsite-PuromycinR
-
Insert Size (bp)9369
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer 5'- GTGAGTTAGCTCACTCATTAGGCACCC -3'
- 3′ sequencing primer 5'- GTT CCG CGC ACA TTT CCC -3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fireworks GFP[PTC+] (AVA2600) was a gift from Joan Steitz (Addgene plasmid # 85446 ; http://n2t.net/addgene:85446 ; RRID:Addgene_85446) -
For your References section:
Fluorescence Amplification Method for Forward Genetic Discovery of Factors in Human mRNA Degradation. Alexandrov A, Shu MD, Steitz JA. Mol Cell. 2017 Jan 5;65(1):191-201. doi: 10.1016/j.molcel.2016.11.032. Epub 2016 Dec 22. 10.1016/j.molcel.2016.11.032 PubMed 28017590