Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85496)


Item Catalog # Description Quantity Price (USD)
Plasmid 85496 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6300
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    Tetrazine2.0 tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
  • Alt name
    Tet2.0 synthetase
  • Species
    Methanocaldococcus jannaschii
  • Insert Size (bp)
  • Mutation
    Y32G L65Q F108S Q109D D158S L162N
  • Promoter lpp (constitutive)
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGTCACTGCGTCTTTTACTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDule-Tet2.0 was a gift from Ryan Mehl (Addgene plasmid # 85496 ; ; RRID:Addgene_85496)
  • For your References section:

    Ideal Bioorthogonal Reactions Using A Site-Specifically Encoded Tetrazine Amino Acid. Blizzard RJ, Backus DR, Brown W, Bazewicz CG, Li Y, Mehl RA. J Am Chem Soc. 2015 Aug 19;137(32):10044-7. doi: 10.1021/jacs.5b03275. Epub 2015 Aug 10. 10.1021/jacs.5b03275 PubMed 26237426