Skip to main content

pDule-para-aminoPhe
(Plasmid #85502)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85502 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDule
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6300
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    p-aminoPhe tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
  • Alt name
    para-aminoPhenylalanine
  • Alt name
    pAF
  • Alt name
    4-aminoPhenylalanine
  • Species
    Methanocaldococcus jannaschii
  • Insert Size (bp)
    921
  • Mutation
    Y32T, E107T, D158P, I159L, L162A
  • Promoter lpp (constitutive)
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGTCACTGCGTCTTTTACTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid has been slightly modified from the original version (Mehl et al., 2003).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDule-para-aminoPhe was a gift from Ryan Mehl (Addgene plasmid # 85502 ; http://n2t.net/addgene:85502 ; RRID:Addgene_85502)
  • For your References section:

    Generation of a bacterium with a 21 amino acid genetic code. Mehl RA, Anderson JC, Santoro SW, Wang L, Martin AB, King DS, Horn DM, Schultz PG. J Am Chem Soc. 2003 Jan 29;125(4):935-9. 10.1021/ja0284153 PubMed 12537491