-
PurposeWork as template for amplification of Streptococcus pneumoniae adapted lacI gene, which is flanked by up- and downstream sequence for integration in prsA locus in S. pneumoniae
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPEPY
- Backbone size w/o insert (bp) 2963
- Total vector size (bp) 5925
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPlease notice that this vector is a container of lacI gene. Expression of lacI in E. coli makes the cells grow very slowly, So we recommend researcher do PCR with E. coli cells without isolating the plasmid.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelacI
-
SpeciesSynthetic
-
Insert Size (bp)2962
- Promoter PF6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer CCCTAAATTTACTAAAGACACTGCTCA
- 3′ sequencing primer TGATAGGGTGGTCTCCGATCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For details of the lacI gene and promoter of PF6, please refer to "Robin Sorg, PhD thesis, Engineering Approaches to Investigate Pneumococcal Gene Expression Regulation and Antibiotic Resistance Development, 2016, ISBN: 978-90-367-9259-2"
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPEPY-PF6-lacI was a gift from Jan-Willem Veening (Addgene plasmid # 85589 ; http://n2t.net/addgene:85589 ; RRID:Addgene_85589) -
For your References section:
High-throughput CRISPRi phenotyping identifies new essential genes in Streptococcus pneumoniae. Liu X, Gallay C, Kjos M, Domenech A, Slager J, van Kessel SP, Knoops K, Sorg RA, Zhang JR, Veening JW. Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449. PubMed 28490437