Skip to main content
Addgene

pSico shSMYD3-C human
(Plasmid #85654)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85654 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSicoR
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shRNA targeting 3'UTR of SMYD3
  • Alt name
    SET and MYND domain containing 3
  • gRNA/shRNA sequence
    TGCGTGTGTCTTTGTTGAATTTCAAGAGAATTCAACAAAGACACACGCTTTTTTC
  • Species
    H. sapiens (human)
  • Entrez Gene
    SMYD3 (a.k.a. KMT3E, ZMYND1, ZNFN3A1, bA74P14.1)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSico shSMYD3-C human was a gift from Julien Sage (Addgene plasmid # 85654 ; http://n2t.net/addgene:85654 ; RRID:Addgene_85654)
  • For your References section:

    SMYD3 links lysine methylation of MAP3K2 to Ras-driven cancer. Mazur PK, Reynoird N, Khatri P, Jansen PW, Wilkinson AW, Liu S, Barbash O, Van Aller GS, Huddleston M, Dhanak D, Tummino PJ, Kruger RG, Garcia BA, Butte AJ, Vermeulen M, Sage J, Gozani O. Nature. 2014 Jun 12;510(7504):283-7. doi: 10.1038/nature13320. Epub 2014 May 21. 10.1038/nature13320 PubMed 24847881