pEJS469-pLK.O1-SpySgRNA/DTS13-Telomere
(Plasmid
#85715)
-
PurposeTelomere-targeting Spy sgRNA under U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
- Total vector size (bp) 7133
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametelomere sgRNA
-
gRNA/shRNA sequenceTTAGGGTTAGGGTTAGGGTT
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BfuAI (destroyed during cloning)
- 3′ cloning site BfuAI (destroyed during cloning)
- 5′ sequencing primer GCATATACGATACAAGGCTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS469-pLK.O1-SpySgRNA/DTS13-Telomere was a gift from Erik Sontheimer (Addgene plasmid # 85715 ; http://n2t.net/addgene:85715 ; RRID:Addgene_85715) -
For your References section:
Naturally Occurring Off-Switches for CRISPR-Cas9. Pawluk A, Amrani N, Zhang Y, Garcia B, Hidalgo-Reyes Y, Lee J, Edraki A, Shah M, Sontheimer EJ, Maxwell KL, Davidson AR. Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8. 10.1016/j.cell.2016.11.017 PubMed 27984730