pMyc-N1
(Plasmid
#85759)
-
Purpose(Empty Backbone) A mammalian expression vector with a Myc-tag at C-terminus.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size (bp) 4040
-
Modifications to backboneEGFP is replaced by Myc tag
-
Vector typeMammalian Expression
- Promoter CMV
-
Selectable markersNeomycin (select with G418)
-
Tag
/ Fusion Protein
- Myc tag (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer 5' CGCAAATGGGCGGTAGGCGTG 3'
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Differs from pEGFP-N1 (Clontech) in containing Myc tag instead of EGFP between BamHI and NotI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMyc-N1 was a gift from Lei Lu (Addgene plasmid # 85759 ; http://n2t.net/addgene:85759 ; RRID:Addgene_85759) -
For your References section:
A ternary complex comprising transportin1, Rab8 and the ciliary targeting signal directs proteins to ciliary membranes. Madugula V, Lu L. J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15. 10.1242/jcs.194019 PubMed 27633000