Skip to main content

pET30ax
(Plasmid #85761)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85761 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-30a
  • Backbone manufacturer
    Novagen
  • Backbone size (bp) 5410
  • Vector type
    Bacterial Expression
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • His tag (N-term and C-term)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Differs from pET-30a (Novagen) in multiple cloning sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET30ax was a gift from Lei Lu (Addgene plasmid # 85761 ; http://n2t.net/addgene:85761 ; RRID:Addgene_85761)
  • For your References section:

    A ternary complex comprising transportin1, Rab8 and the ciliary targeting signal directs proteins to ciliary membranes. Madugula V, Lu L. J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15. 10.1242/jcs.194019 PubMed 27633000