-
Purpose(Empty Backbone) A bacterial expression vector with a His-tag at N and C-terminus.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-30a
-
Backbone manufacturerNovagen
- Backbone size (bp) 5410
-
Vector typeBacterial Expression
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- His tag (N-term and C-term)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Differs from pET-30a (Novagen) in multiple cloning sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET30ax was a gift from Lei Lu (Addgene plasmid # 85761 ; http://n2t.net/addgene:85761 ; RRID:Addgene_85761) -
For your References section:
A ternary complex comprising transportin1, Rab8 and the ciliary targeting signal directs proteins to ciliary membranes. Madugula V, Lu L. J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15. 10.1242/jcs.194019 PubMed 27633000