-
Purpose(Empty Backbone) Tet/Dox inducible shRNA lentivirus with hygromycin selection
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneEZ-Tet-pLKO-Puro
- Backbone size (bp) 8985
-
Modifications to backboneCut out PuroR gene with BamHI and AatII and PCR subcloned in HygroR.
-
Vector typeLentiviral, RNAi
- Promoter H1 / TetO
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Cloning Information
- 5′ sequencing primer ATTAGTGAACGGATCTCGACGG
- 3′ sequencing primer AACCCAGGGCTGCCTTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EZ-Tet-pLKO-Hygro was a gift from Cindy Miranti (Addgene plasmid # 85972 ; http://n2t.net/addgene:85972 ; RRID:Addgene_85972) -
For your References section:
A streamlined method for the design and cloning of shRNAs into an optimized Dox-inducible lentiviral vector. Frank SB, Schulz VV, Miranti CK. BMC Biotechnol. 2017 Feb 28;17(1):24. doi: 10.1186/s12896-017-0341-x. 10.1186/s12896-017-0341-x PubMed 28245848