pICH47742:FCP:Cas9YFP
(Plasmid
#85986)
-
PurposeGolden Gate Level 1 cassette encoding a Cas9-YFP fusion under the FCP promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH47742
-
Backbone manufacturerSylvestre Marillonnet (Addgene #48001)
-
Vector typeCRISPR ; Golden Gate Assembly
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes
- Promoter FCP
-
Tag
/ Fusion Protein
- SV40 NLS, YFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer hSpCas9-R1 (CGCTCGTGCTTCTTATCCTC)
- 3′ sequencing primer EXFP-R
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypTpFCP/NAT described in Poulsen N, Chesley PM, Kröger N. Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae), was domesticated by removing BsaI and BpiI sites through site directed mutagenesis. This was then used as a template for the FCP promoter and terminator. A domesticated, S. pyogenes Cas9 with a human codon bias was used.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was assembled using Golden Gate Cloning as described in Hopes et al., 2016.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH47742:FCP:Cas9YFP was a gift from Thomas Mock (Addgene plasmid # 85986 ; http://n2t.net/addgene:85986 ; RRID:Addgene_85986) -
For your References section:
Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana. Hopes A, Nekrasov V, Kamoun S, Mock T. Plant Methods. 2016 Nov 24;12:49. doi: 10.1186/s13007-016-0148-0. eCollection 2016. 10.1186/s13007-016-0148-0 PubMed 27904648