CD8a-f-CTS-EGFP
(Plasmid
#86063)
-
PurposeA mammalian expression plasmid encoding fibrocystin mimentic clone CD8a-f-CTS (CD8a luminal and transmembrane domains, fibrocystin ciliary targeting signal domains) with C-terminus EGFP.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5382
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFibrocystin
-
SpeciesM. musculus (mouse)
-
Mutationcontains CD8a luminal and transmembrane domains along with ciliary targeting signal (3870-3887 amino acids) of fibrocystin
-
Entrez GenePkhd1 (a.k.a. FPC, Tigm1)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer 5' CGCAAATGGGCGGTAGGCGTG 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CD8a-f-CTS-EGFP was a gift from Lei Lu (Addgene plasmid # 86063 ; http://n2t.net/addgene:86063 ; RRID:Addgene_86063) -
For your References section:
A ternary complex comprising transportin1, Rab8 and the ciliary targeting signal directs proteins to ciliary membranes. Madugula V, Lu L. J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15. 10.1242/jcs.194019 PubMed 27633000