Skip to main content

pTlpA39-Wasabi
(Plasmid #86116)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86116 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone manufacturer
    Novagen
  • Modifications to backbone
    Replaced T7 Promoter #1 with TlpA Promoter. Replaced T7 Promoter #2 with LacI Promoter.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    TlpA39
  • Species
    S. Typhimurium
  • Insert Size (bp)
    1116
  • Mutation
    D341A, D135V, A217V, L236F
  • GenBank ID
    M88208.1
  • Promoter pTlpA, LacI

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gcttgcggccgcataa
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mWasabi
  • Species
    Synthetic
  • Insert Size (bp)
    756
  • GenBank ID
    EU024648.1
  • Promoter pTlpA
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCGTCCGGCGTAGA
  • 3′ sequencing primer ttatgcggccgcaagc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Dr. B. Brett Finlay at the University of British Columbia.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTlpA39-Wasabi was a gift from Mikhail Shapiro (Addgene plasmid # 86116 ; http://n2t.net/addgene:86116 ; RRID:Addgene_86116)
  • For your References section:

    Tunable thermal bioswitches for in vivo control of microbial therapeutics. Piraner DI, Abedi MH, Moser BA, Lee-Gosselin A, Shapiro MG. Nat Chem Biol. 2017 Jan;13(1):75-80. doi: 10.1038/nchembio.2233. Epub 2016 Nov 14. 10.1038/nchembio.2233 PubMed 27842069