pMXs3-NRAS G13D
(Plasmid
#86144)
-
PurposeRetroviral vector expressing NRAS(G13D)-IRES-RFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXs3-IRES-turboRFP
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersRFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNRAS G13D
-
SpeciesH. sapiens (human)
-
MutationG13D
-
Entrez GeneNRAS (a.k.a. ALPS4, CMNS, KRAS, N-ras, NCMS, NRAS1, NS6)
- Promoter LTR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACACGCCGCCCACGTGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs3-NRAS G13D was a gift from David Sabatini (Addgene plasmid # 86144 ; http://n2t.net/addgene:86144 ; RRID:Addgene_86144) -
For your References section:
Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Wang T, Yu H, Hughes NW, Liu B, Kendirli A, Klein K, Chen WW, Lander ES, Sabatini DM. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. 10.1016/j.cell.2017.01.013 PubMed 28162770