Skip to main content

pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZB
(Plasmid #86194)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86194 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTRE-Tight BI
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 2800
  • Total vector size (bp) 6048
  • Vector type
    Mammalian Expression ; Tet on

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    beta Globin
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Mutation
    39TER in beta Globin in MCS II
  • Entrez Gene
    HBB (a.k.a. CD113t-C, ECYT6, beta-globin)
  • Entrez Gene
    Hbb
  • Promoter Tet on

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer CCTGGAGATTTCGAGCTCGG
  • 3′ sequencing primer TAT TAC CGC CTT TGA GTG AGC TGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZB was a gift from Robert Singer (Addgene plasmid # 86194 ; http://n2t.net/addgene:86194 ; RRID:Addgene_86194)
  • For your References section:

    Temporal and spatial characterization of nonsense-mediated mRNA decay. Trcek T, Sato H, Singer RH, Maquat LE. Genes Dev. 2013 Mar 1;27(5):541-51. doi: 10.1101/gad.209635.112. Epub 2013 Feb 21. 10.1101/gad.209635.112 PubMed 23431032