-
Purposebeta Globin NMD construct with and without PTC under Bi-directional TET on promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86194 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRE-Tight BI
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 2800
- Total vector size (bp) 6048
-
Vector typeMammalian Expression ; Tet on
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer CCTGGAGATTTCGAGCTCGG
- 3′ sequencing primer TAT TAC CGC CTT TGA GTG AGC TGA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZB was a gift from Robert Singer (Addgene plasmid # 86194 ; http://n2t.net/addgene:86194 ; RRID:Addgene_86194) -
For your References section:
Temporal and spatial characterization of nonsense-mediated mRNA decay. Trcek T, Sato H, Singer RH, Maquat LE. Genes Dev. 2013 Mar 1;27(5):541-51. doi: 10.1101/gad.209635.112. Epub 2013 Feb 21. 10.1101/gad.209635.112 PubMed 23431032