Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pYPQ141-ZmUbi-RZ-As
(Plasmid #86196)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86196 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AsCpf1 gRNA cloning site for ribozyme cleavage
  • gRNA/shRNA sequence
    gRNA scaffold only
  • Species
    Acidaminococcus sp. BV3L6
  • Promoter Maize ubiquitin 1
  • Tag / Fusion Protein
    • Hammerhead ribozyme and HDV ribozyme

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ttcccagtcacgacgttgtaaaac
  • 3′ sequencing primer catggtcatagctgtttcctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYPQ141-ZmUbi-RZ-As was a gift from Yiping Qi (Addgene plasmid # 86196 ; http://n2t.net/addgene:86196 ; RRID:Addgene_86196)
  • For your References section:

    A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Tang X, Lowder LG, Zhang T, Malzahn AA, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y. Nat Plants. 2017 Feb 17;3:17018. doi: 10.1038/nplants.2017.18. 10.1038/nplants.2017.18 PubMed 28211909