Skip to main content

pAP84
(Plasmid #86554)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86554 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRPF185
  • Backbone manufacturer
    Robert Fagan and Neil Fairweather
  • Backbone size w/o insert (bp) 6378
  • Total vector size (bp) 7072
  • Modifications to backbone
    Cut KnpI, BamHI to remove Ptet-gusA; insertion of Pveg-sLucopt
  • Vector type
    Bacterial Expression, Luciferase, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Occasional insertions of an IS element commonly found in E.coli cloning strains is observed; the Pveg promoter seems particularly prone to insertions. If problems are encountered, we recommend maintaining the plasmid in, and isolating it from, strains that are negative for this element. By PCR, MC1061 or derivative strains are negative. DH5a or derivatives should be avoided. IS-less cloning strains (such as MDS42) are recommended. Growth on 20ug/mL Cm on plate (E.coli), or 10 ug/mL Cm in liquid culture (E.coli). For C. difficile selection use Thiamphenicol at 15 ug/mL.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pveg-sLucopt
  • Alt name
    secreted luciferase expressed from constitutive promoter
  • Species
    Synthetic; Bacillus subtilis
  • Insert Size (bp)
    694
  • GenBank ID
    NC_000964
  • Promoter Pveg

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer NF_793 (CACCTCCTTTTTGACTTTAAGCCTACGAATACC)
  • 3′ sequencing primer NF_794 (CACCGACGAGCAAGGCAAGACCG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the individual components of this construct (that is, Pveg and sLucopt) are described in Oliveira Paiva AM et al (2016) ACS Synth Biol (DOI: 10.1021/acssynbio.6b00104). During the cloning a mutation occurred that removes the SacI site in between the Pveg and sLucopt genes. The 5' (KpnI) and 3' (BamHI) restriction sites remain.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAP84 was a gift from Wiep Klaas Smits (Addgene plasmid # 86554 ; http://n2t.net/addgene:86554 ; RRID:Addgene_86554)