Skip to main content

pUB-Cas9
(Plasmid #86556)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86556 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKB65
  • Backbone manufacturer
    Kristin Bernhardt
  • Backbone size w/o insert (bp) 11630
  • Total vector size (bp) 14121
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    Synthetic
  • Insert Size (bp)
    4137
  • Mutation
    Cas9 is codon optimized for C. reinhardtii
  • Promoter UBIQUITIN10

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTTCGTTCGATCCCAATTTC
  • 3′ sequencing primer aagaccggcaacaggattc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Peter Hegemann, HU Berlin

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See Hahn et al., 2017

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUB-Cas9 was a gift from Andreas Weber (Addgene plasmid # 86556 ; http://n2t.net/addgene:86556 ; RRID:Addgene_86556)
  • For your References section:

    An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Hahn F, Mantegazza O, Greiner A, Hegemann P, Eisenhut M, Weber AP. Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017. 10.3389/fpls.2017.00039 PubMed 28174584