pU6-gRNA-TAZ
(Plasmid
#86688)
-
PurposeExpresses a gRNA targeted to human TAZ
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86688 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR-Blunt-II
-
Backbone manufacturerLife Technologies
-
Modifications to backboneInserted gBlock containing U6 promoter and TAZ gRNA
-
Vector typeCRISPR
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6-gRNA-TAZ
-
gRNA/shRNA sequenceGAAGCTCAACCATGGGGACT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_000116
-
Entrez GeneTAFAZZIN (a.k.a. BTHS, CMD3A, EFE, EFE2, G4.5, LVNCX, TAZ, Taz1)
- Promoter U6
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13R
- 3′ sequencing primer M13F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-gRNA-TAZ was a gift from William Pu (Addgene plasmid # 86688 ; http://n2t.net/addgene:86688 ; RRID:Addgene_86688) -
For your References section:
Efficient, footprint-free human iPSC genome editing by consolidation of Cas9/CRISPR and piggyBac technologies. Wang G, Yang L, Grishin D, Rios X, Ye LY, Hu Y, Li K, Zhang D, Church GM, Pu WT. Nat Protoc. 2017 Jan;12(1):88-103. doi: 10.1038/nprot.2016.152. Epub 2016 Dec 8. 10.1038/nprot.2016.152 PubMed 27929521