pPotef-LN22*-3xGNLS-cbx
(Plasmid
#86780)
-
PurposeExpresses lambda N protein fused to triple Gfp coupled to an NLS sequence under the control of the constitutively active Potef promotor.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86780 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC57
- Total vector size (bp) 7896
-
Vector typeBacterial Expression ; Ustilago maydis Expression
-
Selectable markersCarboxine
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLN*
-
Alt namelambdaN
-
SpeciesPhage
-
Insert Size (bp)69
- Promoter Potef
-
Tag
/ Fusion Protein
- Gfp (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TCCAATAAAGGGCGCTGTCTCGGC
- 3′ sequencing primer TGTGGCCGTTTACGTCGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPotef-LN22*-3xGNLS-cbx was a gift from Michael Feldbrügge (Addgene plasmid # 86780 ; http://n2t.net/addgene:86780 ; RRID:Addgene_86780) -
For your References section:
A FYVE zinc finger domain protein specifically links mRNA transport to endosome trafficking. Pohlmann T, Baumann S, Haag C, Albrecht M, Feldbrugge M. Elife. 2015 May 18;4. doi: 10.7554/eLife.06041. 10.7554/eLife.06041 PubMed 25985087